Hot StartTaq2X Master Mix from New England Biolabs

Product Specs
ItemHot StartTaq2X Master Mix
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberM0496S
Quantity100 reactions
ApplicationsDNA Analysis
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeMaster Mix
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Genome Sequence of Fowlpox Virus-Integrated Reticuloendotheliosis Virus from a Rio Grande Wild Turkey (Meleagris gallopavo intermedia )Microbiology Resource AnnouncementsJune 16, 2022Bianca Willis, Camille Trautman, Faith Cox, Tiffany Lujan, Jason Hardin, Robert Dittmar, Camila Romano, Jeff Brady, Dustin Edwardsisolate TSU-1029 contained an REV proviral genome insertion, PCR using Hot Start Taq 2× master mix (NEB; M0496L) and the heterologous primers REV env 7F and FPV 203 4R produced an appropriately sized 740-bp product

(2) NASP maintains histone H3-H4 homeostasis through two distinct H3 binding modesNucleic acids researchMay 20, 2022Bao H, Carraro M, Flury V, Liu Y, Luo M, Chen L, Groth A, Huang H.10 minutes. 2 μl of this lysate was directly used for PCR reactions with 2 × Taq start master mix (M0496L, NEB), and the two NASP clone screening primers (see primer table). Amplified DNA was sequenced using

(3) Reconstructing the Lineage Histories and Differentiation Trajectories of Individual Cancer Cells in Myeloproliferative NeoplasmsCell stem cellMarch 4, 2021Van Egeren D, Escabi J, Nguyen M, Liu S, Reilly CR, Patel S, Kamaz B, Kalyva M, DeAngelo DJ, Galinsky I, et al.previously. In Step 3, a 25uL PCR mixture was made containing 12.5uL of Hot Start Taq 2x Master Mix (NEB #M0496S), 1.25uL of cDNA additive (10x Genomics #220067), 1.25uL of forward primer (Partial P5, AATGATACGGCGACCACCGAGATCT)

(4) Nucleic acid detection aboard the International Space Station by colorimetric loop‐mediated isothermal amplification (LAMP)FASEB BioAdvancesMarch 1, 2020Julian Rubinfien et al.Q5 Hot Start High‐Fidelity 2X Master Mix (NEB M0494; New England Biolabs, Inc) or Hot Start Taq 2X Master Mix (NEB M0496; New England Biolabs, Inc), along with 5 μL primers prepared at 5 μmol/L concentration, 18 μL distilled

(5) Recovery of Renal Function following Kidney-Specific VEGF Therapy in Experimental Renovascular DiseaseAmerican journal of nephrologyJanuary 1, 2020Engel JE, Williams ML, Williams E, Azar C, Taylor EB, Bidwell GL, Chade AR.(Thermo Scientific, K1621). qPCR was performed using Hot Start Taq 2x Master Mix (New England BioLabs, M0496L). Samples were probed using primer pairs for Beta Actin (Hs01060665_g1), VEGF (Hs00900055_m1), KDR/Flk-1

(6) Metabolic Control of Astrocyte Pathogenic Activity via cPLA2-MAVSCellDecember 12, 2019Chao CC, Gutiérrez-Vázquez C, Rothhammer V, Mayo L, Wheeler MA, Tjon EC, Zandee SEJ, Blain M, de Lima KA, Takenaka MC, et al.DAPI Fluoromount-G,SouthernBiotech,Cat#0100–20 NuPAGE LDS sample buffer,Invitrogen,Cat#NP0007 Hot Start Taq 2X Master Mix,New England Biolabs,Cat#M0496 FuGENE HD Transfection Reagent,Promega,Cat#E2311 UK-5099,Tocris Bioscience,Cat#4186 methylglyoxal

(7) Demonstration of End-to-End Automation of DNA Data StorageScientific ReportsDecember 1, 2019Christopher N. Takahashi, Bichlien H. Nguyen, Karin Strauss, Luis Cezekilobase fragment that was PCR-amplified from the lambda genome using hot start TAQ DNA polymerase (NEB M0496) with a Bsa-I restriction site added by the forward primer. The resulting fragment after digestion had

(8) Aptamers in the Therapeutics and Diagnostics PipelinesTheranosticsJuly 1, 2018Harleen Kaur, John G. Bruno, Amit Kumar, Tarun Kumar Sharmaenzymes and other molecular biology reagents, has commercialized Hot Start Taq DNA polymerase (Cat No. M0496S and M0490S). Both of these products principally rely on an aptamer-based hot start technology to avoid

(9) Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal TransferJournal of BacteriologyApril 1, 2017Anthony W. Kingston, Christine Ponkratz, Elisabeth A. Raleigh(catalog number M0491; NEB), while diagnostic PCRs used the Hot Start Taq 2× master mix (catalog number M0496; NEB). Matings. Donor and recipient cultures were grown at 37°C to an optical density at 600 nm (OD600)

(10) Novel recA-Independent Horizontal Gene Transfer in Escherichia coli K-12PLOS ONEJuly 10, 2015Anthony W. Kingston, Chloé Roussel-Rossin, Claire Dupont, Elisabeth A. Raleigh(#M0491; New England Biolabs) while diagnostic PCR reactions used the Hot Start Taq 2X Master Mix (#M0496; New England Biolabs). New England Biolabs produced all restriction enzymes and ligases used in these

Be the First to Write a Review!